Skip to main content

Lenti_CRISPRi_sgAR2
(Plasmid #167001)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167001 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiGuide_Hygro-eGFP
  • Backbone manufacturer
    Addgene #99375
  • Backbone size w/o insert (bp) 9524
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Hygromycin ; EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AR Promoter sgRNA 2
  • gRNA/shRNA sequence
    CACCGCAGCCTAACCAGGCGGGTCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    AR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
  • Promoter U6

Cloning Information

  • Cloning method Ligation Independent Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti_CRISPRi_sgAR2 was a gift from Gian-Paolo Dotto (Addgene plasmid # 167001 ; http://n2t.net/addgene:167001 ; RRID:Addgene_167001)
  • For your References section:

    Sustained androgen receptor signaling is a determinant of melanoma cell growth potential and tumorigenesis. Ma M, Ghosh S, Tavernari D, Katarkar A, Clocchiatti A, Mazzeo L, Samarkina A, Epiney J, Yu YR, Ho PC, Levesque MP, Ozdemir BC, Ciriello G, Dummer R, Dotto GP. J Exp Med. 2021 Feb 1;218(2). pii: 211509. doi: 10.1084/jem.20201137. 10.1084/jem.20201137 PubMed 33112375