pX020
(Plasmid
#167146)
-
PurposeMoClo-compatible Level 0-CDS1 promoterless vector encoding Neonothopanus nambi caffeoylpiruvate nnCPH codon-optimised for expression in Nicotiana benthamiana
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLevel0-CDS1-like
- Backbone size w/o insert (bp) 2248
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefungal caffeoylpiruvate hydrolase, nnCPH
-
SpeciesNeonothopanus nambi
-
Insert Size (bp)920
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer gagcgaggaagcggaagagcgccc
- 3′ sequencing primer accattattatcatgacattaacc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX020 was a gift from Karen Sarkisyan (Addgene plasmid # 167146 ; http://n2t.net/addgene:167146 ; RRID:Addgene_167146) -
For your References section:
Plants with genetically encoded autoluminescence. Mitiouchkina T, Mishin AS, Somermeyer LG, Markina NM, Chepurnyh TV, Guglya EB, Karataeva TA, Palkina KA, Shakhova ES, Fakhranurova LI, Chekova SV, Tsarkova AS, Golubev YV, Negrebetsky VV, Dolgushin SA, Shalaev PV, Shlykov D, Melnik OA, Shipunova VO, Deyev SM, Bubyrev AI, Pushin AS, Choob VV, Dolgov SV, Kondrashov FA, Yampolsky IV, Sarkisyan KS. Nat Biotechnol. 2020 Apr 27. pii: 10.1038/s41587-020-0500-9. doi: 10.1038/s41587-020-0500-9. 10.1038/s41587-020-0500-9 PubMed 32341562