pEGFP ratAPOBEC1 L173A/G227A
(Plasmid
#167169)
-
PurposeExpresses rat APOBEC1 L173A/G227A in mammalian cells. Please note that this does not express GFP.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3943
- Total vector size (bp) 4627
-
Modifications to backbonethe EGFP cds has been removed
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPOBEC1
-
Alt nameapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)603
-
Mutationchanged Leucine 173 to Alanine; changed Glycine 227 to Alanine
-
GenBank IDNM_012907
-
Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
- Promoter CMV promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP ratAPOBEC1 L173A/G227A was a gift from Silvestro Conticello (Addgene plasmid # 167169 ; http://n2t.net/addgene:167169 ; RRID:Addgene_167169) -
For your References section:
Dimerisation of APOBEC1 is dispensable for its RNA editing activity. Chieca M, Montini M, Severi F, Pecori R, Conticello S. bioRxiv 2021 10.1101/410803