Skip to main content

pLenti-3xFLAG-Puro PAK5 K478R K469R
(Plasmid #167180)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167180 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p-Lenti-puro
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PAK5 K478R K469R
  • Alt name
    PAK7 K478R K469R
  • Species
    H. sapiens (human)
  • Promoter UBC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAAATTGTCCGCTAAATTCTGGCCGTT
  • 3′ sequencing primer CACACCGGCCTTATTCCAAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pDEST-PAK5 was kindly provided by Dr. J. Brognard

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-3xFLAG-Puro PAK5 K478R K469R was a gift from Christin Burd (Addgene plasmid # 167180 ; http://n2t.net/addgene:167180 ; RRID:Addgene_167180)
  • For your References section:

    Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways. LaPak KM, Vroom DC, Garg AA, Guan X, Hays JL, Song JW, Burd CE. Oncotarget. 2018 May 22;9(39):25386-25401. doi: 10.18632/oncotarget.25356. eCollection 2018 May 22. 10.18632/oncotarget.25356 PubMed 29875996