Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-3xFLAG-Puro PAK5 K478R K469R
(Plasmid #167180)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167180 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p-Lenti-puro
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PAK5 K478R K469R
  • Alt name
    PAK7 K478R K469R
  • Species
    H. sapiens (human)
  • Promoter UBC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAAATTGTCCGCTAAATTCTGGCCGTT
  • 3′ sequencing primer CACACCGGCCTTATTCCAAGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-3xFLAG-Puro PAK5 K478R K469R was a gift from Christin Burd (Addgene plasmid # 167180 ; http://n2t.net/addgene:167180 ; RRID:Addgene_167180)
  • For your References section:

    Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways. LaPak KM, Vroom DC, Garg AA, Guan X, Hays JL, Song JW, Burd CE. Oncotarget. 2018 May 22;9(39):25386-25401. doi: 10.18632/oncotarget.25356. eCollection 2018 May 22. 10.18632/oncotarget.25356 PubMed 29875996