pLenti-3xFLAG-Puro PAK5 K478R/479R M173I
(Plasmid
#167197)
-
Purposepuromycin resistant lentiviral vector for expression of PAK5 K478R/479R M173I; PAK7 Kinase dead & M173I double mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep-Lenti-puro
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePAK5 K478R/479R M173I
-
Alt namePAK7 K478R/479R M173I
-
SpeciesH. sapiens (human)
- Promoter UBC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAATTGTCCGCTAAATTCTGGCCGTT
- 3′ sequencing primer CACACCGGCCTTATTCCAAGCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypDEST-PAK5 was kindly provided by Dr. J. Brognard
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-3xFLAG-Puro PAK5 K478R/479R M173I was a gift from Christin Burd (Addgene plasmid # 167197 ; http://n2t.net/addgene:167197 ; RRID:Addgene_167197) -
For your References section:
Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways. LaPak KM, Vroom DC, Garg AA, Guan X, Hays JL, Song JW, Burd CE. Oncotarget. 2018 May 22;9(39):25386-25401. doi: 10.18632/oncotarget.25356. eCollection 2018 May 22. 10.18632/oncotarget.25356 PubMed 29875996