-
PurposeLentiviral expression construct encoding a TagBFP in frame with a self-cleaving wild-type RLR sensor RIG-I
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRIP-SFFV
- Backbone size w/o insert (bp) 10356
- Total vector size (bp) 13134
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersTagBFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDDX58
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2778
-
Entrez GeneRIGI (a.k.a. DDX58, RIG-I, RIG1, RLR-1, SGMRT2)
- Promoter SFFV
-
Tag
/ Fusion Protein
- tagBFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer cgcttctgcttcccgagctc
- 3′ sequencing primer cttctagccaggcacaatcagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.01.31.929075v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIP-SFFV-mtagBFP-2A RIGI WT was a gift from Agnel Sfeir (Addgene plasmid # 167289 ; http://n2t.net/addgene:167289 ; RRID:Addgene_167289) -
For your References section:
Nuclear sensing of breaks in mitochondrial DNA enhances immune surveillance. Tigano M, Vargas DC, Tremblay-Belzile S, Fu Y, Sfeir A. Nature. 2021 Mar;591(7850):477-481. doi: 10.1038/s41586-021-03269-w. Epub 2021 Feb 24. 10.1038/s41586-021-03269-w PubMed 33627873