Skip to main content

pLKO.1 puro_shDDX58_230212
(Plasmid #167293)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167293 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 7026
  • Total vector size (bp) 7084
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA hsDDX58
  • Alt name
    RIG-I
  • gRNA/shRNA sequence
    CCGGAGCACTTGTGGACGCTTTAAACTCGAGTTTAAAGCGTCCACAAGTGCTTTTTTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    RIGI (a.k.a. DDX58, RIG-I, RIG1, RLR-1, SGMRT2)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 puro_shDDX58_230212 was a gift from Agnel Sfeir (Addgene plasmid # 167293 ; http://n2t.net/addgene:167293 ; RRID:Addgene_167293)
  • For your References section:

    Nuclear sensing of breaks in mitochondrial DNA enhances immune surveillance. Tigano M, Vargas DC, Tremblay-Belzile S, Fu Y, Sfeir A. Nature. 2021 Mar;591(7850):477-481. doi: 10.1038/s41586-021-03269-w. Epub 2021 Feb 24. 10.1038/s41586-021-03269-w PubMed 33627873