pLKO.1 puro_shDDX58_230212
(Plasmid
#167293)
-
PurposeLentiviral plKO.1 construct coding for a short-hairpin RNA targeting the human gene DDX58 (coding for RLR sensor RIG-I). Contains a puro resistance cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 7026
- Total vector size (bp) 7084
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA hsDDX58
-
Alt nameRIG-I
-
gRNA/shRNA sequenceCCGGAGCACTTGTGGACGCTTTAAACTCGAGTTTAAAGCGTCCACAAGTGCTTTTTTG
-
SpeciesH. sapiens (human)
-
Entrez GeneRIGI (a.k.a. DDX58, RIG-I, RIG1, RLR-1, SGMRT2)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.01.31.929075v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 puro_shDDX58_230212 was a gift from Agnel Sfeir (Addgene plasmid # 167293 ; http://n2t.net/addgene:167293 ; RRID:Addgene_167293) -
For your References section:
Nuclear sensing of breaks in mitochondrial DNA enhances immune surveillance. Tigano M, Vargas DC, Tremblay-Belzile S, Fu Y, Sfeir A. Nature. 2021 Mar;591(7850):477-481. doi: 10.1038/s41586-021-03269-w. Epub 2021 Feb 24. 10.1038/s41586-021-03269-w PubMed 33627873