His-TEV-EGFP-PRC1
(Plasmid
#167540)
-
PurposeFor expression of His6-TEV-EGFP-PRC1 in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167540 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7825
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsIPTG inducible.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRC1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1863
-
GenBank IDNP_003972
-
Entrez GenePRC1 (a.k.a. ASE1, MAP65)
- Promoter T7
-
Tags
/ Fusion Proteins
- His6 tag (N terminal on backbone)
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-TEV-EGFP-PRC1 was a gift from Tarun Kapoor (Addgene plasmid # 167540 ; http://n2t.net/addgene:167540 ; RRID:Addgene_167540) -
For your References section:
Marking and measuring single microtubules by PRC1 and kinesin-4. Subramanian R, Ti SC, Tan L, Darst SA, Kapoor TM. Cell. 2013 Jul 18;154(2):377-90. doi: 10.1016/j.cell.2013.06.021. 10.1016/j.cell.2013.06.021 PubMed 23870126