HA, EGFP Spastin M87 with exon 4, N386C
(Plasmid
#167543)
-
PurposeFor doxycycline inducible mammalian expression of EGFP tagged Spastin M87 with exon 4, with N386C mutation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5137
- Total vector size (bp) 7440
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpastin M87 with exon 4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1593
-
MutationN386C
-
GenBank IDNM_014946.3
-
Entrez GeneSPAST (a.k.a. ADPSP, FSP2, SPG4)
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA tag (N terminal on backbone)
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA, EGFP Spastin M87 with exon 4, N386C was a gift from Tarun Kapoor (Addgene plasmid # 167543 ; http://n2t.net/addgene:167543 ; RRID:Addgene_167543) -
For your References section:
Designing a chemical inhibitor for the AAA protein spastin using active site mutations. Cupido T, Pisa R, Kelley ME, Kapoor TM. Nat Chem Biol. 2019 May;15(5):444-452. doi: 10.1038/s41589-019-0225-6. Epub 2019 Feb 18. 10.1038/s41589-019-0225-6 PubMed 30778202