Skip to main content

pGFP-HBO1-G485A pc2201
(Plasmid #167570)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167570 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 6555
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    histone acetyltransferase 1
  • Species
    H. sapiens (human)
  • Mutation
    G485A
  • GenBank ID
    AF074606.1
  • Entrez Gene
    KAT7 (a.k.a. HBO1, HBOA, MYST2, ZC2HC7)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACAAGGAGTACCTGAGC
  • 3′ sequencing primer CTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP-HBO1-G485A pc2201 was a gift from Cristina Cardoso (Addgene plasmid # 167570 ; http://n2t.net/addgene:167570 ; RRID:Addgene_167570)
  • For your References section:

    DNA replication dynamics of vole genome and its epigenetic regulation. Heinz KS, Rapp A, Casas-Delucchi CS, Lehmkuhl A, Romero-Fernandez I, Sanchez A, Kramer OH, Marchal JA, Cardoso MC. Epigenetics Chromatin. 2019 Mar 14;12(1):18. doi: 10.1186/s13072-019-0262-0. 10.1186/s13072-019-0262-0 PubMed 30871586