pRU54
(Plasmid
#167680)
-
PurposeFinal destination vector for single Gateway LR reaction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167680 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDe-CAS9
-
Vector typeCRISPR
-
Selectable markersFastGreen seed selection
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepEC1.2::spCas9
-
SpeciesStreptococcus pyogenes
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gcggataacaatttcacacaggaaacag
- 3′ sequencing primer gcttgcatgcctgcaggtcgactct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In addition to Cas9 cassette, attR1-attR2 Gateway recombination sites together with ccdB cassette are present.
Please visit https://www.biorxiv.org/content/10.1101/2021.05.20.444986v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRU54 was a gift from Niko Geldner (Addgene plasmid # 167680 ; http://n2t.net/addgene:167680 ; RRID:Addgene_167680) -
For your References section:
Combined fluorescent seed selection and multiplex CRISPR/Cas9 assembly for fast generation of multiple Arabidopsis mutants. Ursache R, Fujita S, Denervaud Tendon V, Geldner N. Plant Methods. 2021 Oct 30;17(1):111. doi: 10.1186/s13007-021-00811-9. 10.1186/s13007-021-00811-9 PubMed 34717688