Skip to main content

pRU321
(Plasmid #167681)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167681 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDe-CAS9
  • Vector type
    CRISPR
  • Selectable markers
    FastRed seed selection

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PcUB4-2::asCas9
  • Species
    Staphylococcus aureus

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gcggataacaatttcacacaggaaacag
  • 3′ sequencing primer gcttgcatgcctgcaggtcgactct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In addition to Cas9 cassette, attR1-attR2 Gateway recombination sites together with ccdB cassette are present.

Please visit https://www.biorxiv.org/content/10.1101/2021.05.20.444986v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRU321 was a gift from Niko Geldner (Addgene plasmid # 167681 ; http://n2t.net/addgene:167681 ; RRID:Addgene_167681)
  • For your References section:

    Combined fluorescent seed selection and multiplex CRISPR/Cas9 assembly for fast generation of multiple Arabidopsis mutants. Ursache R, Fujita S, Denervaud Tendon V, Geldner N. Plant Methods. 2021 Oct 30;17(1):111. doi: 10.1186/s13007-021-00811-9. 10.1186/s13007-021-00811-9 PubMed 34717688