miniTol2 x EF1a_EKAREN4 + PGK-puro
(Plasmid
#167824)
-
PurposeOptimized EKAREV FRET biosensor sensor for ERK
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneminiTol2 expression vector
- Backbone size w/o insert (bp) 3450
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEKAREN4
-
SpeciesSynthetic
-
Insert Size (bp)1950
-
MutationK424P, K426W
- Promoter EF1a
-
Tag
/ Fusion Protein
- nls localization motif (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
- 3′ sequencing primer AATGTTAACGACCGGt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEKAREV (Komatsu et al.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We received EKAREV FRET biosensor from Matsuda-lab (Japan). We subsequently improved by insertion of a Turquoise2 synthetic DNA, including 169 silent mutations (reducing recombination) and adapted the sensor domain by point mutagenesis. The generation of stable cell lines using this plasmid requires the co-transfection of a transposase-expressing plasmid. The depositing lab recommends the use of Plasmid 158774.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miniTol2 x EF1a_EKAREN4 + PGK-puro was a gift from Hugo Snippert (Addgene plasmid # 167824 ; http://n2t.net/addgene:167824 ; RRID:Addgene_167824) -
For your References section:
Quantifying single-cell ERK dynamics in colorectal cancer organoids reveals EGFR as an amplifier of oncogenic MAPK pathway signalling. Ponsioen B, Post JB, Buissant des Amorie JR, Laskaris D, van Ineveld RL, Kersten S, Bertotti A, Sassi F, Sipieter F, Cappe B, Mertens S, Verlaan-Klink I, Boj SF, Vries RGJ, Rehmann H, Vandenabeele P, Riquet FB, Trusolino L, Bos JL, Snippert HJG. Nat Cell Biol. 2021 Apr;23(4):377-390. doi: 10.1038/s41556-021-00654-5. Epub 2021 Apr 1. 10.1038/s41556-021-00654-5 PubMed 33795873