pBLADE_ONLY_A
(Plasmid
#168051)
-
PurposeExpresses the synthetic gene BLADE FP6 under the constitutive J23101** promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTrc99a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBlue light-inducible AraC dimers in Escherichia coli
-
Alt nameBLADE
-
SpeciesSynthetic
-
Insert Size (bp)828
- Promoter J23101**
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCATACGCTCTACGCTCC
- 3′ sequencing primer TCGGGTGACTGAAGAAAACGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBLADE_ONLY_A was a gift from Barbara Di Ventura (Addgene plasmid # 168051 ; http://n2t.net/addgene:168051 ; RRID:Addgene_168051) -
For your References section:
Engineering AraC to make it responsive to light instead of arabinose. Romano E, Baumschlager A, Akmeric EB, Palanisamy N, Houmani M, Schmidt G, Ozturk MA, Ernst L, Khammash M, Di Ventura B. Nat Chem Biol. 2021 Apr 26. pii: 10.1038/s41589-021-00787-6. doi: 10.1038/s41589-021-00787-6. 10.1038/s41589-021-00787-6 PubMed 33903769