pAc-His-zfCsf1a
(Plasmid
#168103)
-
PurposeExpress soluble His-tagged zebrafish Csf1a in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAcGP-67B
- Backbone size w/o insert (bp) 9748
- Total vector size (bp) 10526
-
Modifications to backbone6xHis tag insert
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCsf1a
-
Alt nameM-CSFa
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)545
-
GenBank IDNM_001114480
-
Entrez Genecsf1a (a.k.a. csf1-, csf1-1, mcsf, zgc:172186)
-
Tag
/ Fusion Protein
- 6x His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCGGATTATTCATACCGTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc-His-zfCsf1a was a gift from Petr Bartunek (Addgene plasmid # 168103 ; http://n2t.net/addgene:168103 ; RRID:Addgene_168103) -
For your References section:
M-CSFR/CSF1R signaling regulates myeloid fates in zebrafish via distinct action of its receptors and ligands. Hason M, Mikulasova T, Machonova O, Pombinho AR, van Ham TJ, Irion U, Nusslein-Volhard C, Bartunek P, Svoboda O. Blood Adv. 2022 Jan 3. pii: 483305. doi: 10.1182/bloodadvances.2021005459. 10.1182/bloodadvances.2021005459 PubMed 34979548