-
PurposeMammalian expression of mKalama1 blue fluorescent protein with NLS
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 14894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEYFP-Nuc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepmKalama1-Nuc
-
Alt namemKalama1 blue fluorescent protein with NLS
-
Speciesevolved fluorescent protein
-
Insert Size (bp)720
-
MutationI178T mismatch, replace EYFP of the vector pEYFP-Nuc from Clontech with mKalama1.
-
GenBank IDEF517317
-
Tag
/ Fusion Protein
- NLS (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmKalama1-Nuc was a gift from Robert Campbell (Addgene plasmid # 14894 ; http://n2t.net/addgene:14894 ; RRID:Addgene_14894) -
For your References section:
Exploration of New Chromophore Structures Leads to the Identification of Improved Blue Fluorescent Proteins. Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Biochemistry. 2007 Apr 20. ():. 10.1021/bi700199g PubMed 17444659