Skip to main content
Addgene
Open Menu

pmKalama1-Nuc
(Plasmid #14894)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 14894 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 14894-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 14894-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEYFP-Nuc
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Modifications to backbone
    Replaced EYFP of the vector pEYFP-Nuc from Clontech with mKalama1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pmKalama1-Nuc
  • Alt name
    mKalama1 blue fluorescent protein with NLS
  • Species
    evolved fluorescent protein
  • Insert Size (bp)
    720
  • Mutation
    I178T
  • GenBank ID
    EF517317
  • Promoter CMV
  • Tag / Fusion Protein
    • NLS (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmKalama1-Nuc was a gift from Robert Campbell (Addgene plasmid # 14894 ; http://n2t.net/addgene:14894 ; RRID:Addgene_14894)

  • For your References section:

    Exploration of New Chromophore Structures Leads to the Identification of Improved Blue Fluorescent Proteins. Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Biochemistry. 2007 May 22;46(20):5904-10. doi: 10.1021/bi700199g 10.1021/bi700199g PubMed 17444659
Related items:
Commonly requested with: