Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pmKalama1-Nuc
(Plasmid #14894)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 14894 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEYFP-Nuc
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pmKalama1-Nuc
  • Alt name
    mKalama1 blue fluorescent protein with NLS
  • Species
    evolved fluorescent protein
  • Insert Size (bp)
    720
  • Mutation
    I178T mismatch, replace EYFP of the vector pEYFP-Nuc from Clontech with mKalama1.
  • GenBank ID
    EF517317
  • Tag / Fusion Protein
    • NLS (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmKalama1-Nuc was a gift from Robert Campbell (Addgene plasmid # 14894 ; http://n2t.net/addgene:14894 ; RRID:Addgene_14894)
  • For your References section:

    Exploration of New Chromophore Structures Leads to the Identification of Improved Blue Fluorescent Proteins. Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Biochemistry. 2007 Apr 20. ():. 10.1021/bi700199g PubMed 17444659