Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #18879)


Item Catalog # Description Quantity Price (USD)
Plasmid 18879 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    caspase-3 sensor
  • Species
    H. sapiens (human); lab constructed
  • Insert Size (bp)
  • Mutation
    mAmetrine-tdTomato linker sequence: ...ITLGGTGSGSGDEVDGMVSKGEEVIK...; Backbone NLS tag has been removed when digested with BamH1
  • Entrez Gene
    CASP3 (a.k.a. CPP32, CPP32B, SCA-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmAmetrine-DEVD-tdTomato was a gift from Robert Campbell (Addgene plasmid # 18879 ; ; RRID:Addgene_18879)
  • For your References section:

    Fluorescent protein FRET pairs for ratiometric imaging of dual biosensors. Ai HW, Hazelwood KL, Davidson MW, Campbell RE. Nat Methods. 2008 May . 5(5):401-3. 10.1038/nmeth.1207 PubMed 18425137