pmAmetrine-DEVD-tdTomato
(Plasmid #18879)

• Purpose: Caspase-3 FRET biosensor, mammalian expression of mAmetrine-DEVD-tdTomato
• Depositing Lab: Robert Campbell
• Publication: Ai et al Nat Methods. 2008 May . 5(5):401-3.

Backbone

• Vector backbone: pEYFP-Nuc
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 4000
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mAmetrine-DEVD-tdTomato
• Alt name: caspase-3 sensor
• Species: H. sapiens (human); lab constructed
• Insert Size (bp): 2100
• Mutation: mAmetrine-tdTomato linker sequence: ...ITLGGTGSGSGDEVDGMVSKGEEVIK...; Backbone NLS tag has been removed when digested with BamH1
• Entrez Gene: CASP3 (a.k.a. CPP32, CPP32B, SCA-1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe1 (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG
• 3′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry