-
PurposeCaspase-3 FRET biosensor, mammalian expression of mAmetrine-DEVD-tdTomato
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEYFP-Nuc
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemAmetrine-DEVD-tdTomato
-
Alt namecaspase-3 sensor
-
SpeciesH. sapiens (human); lab constructed
-
Insert Size (bp)2100
-
MutationmAmetrine-tdTomato linker sequence: ...ITLGGTGSGSGDEVDGMVSKGEEVIK...; Backbone NLS tag has been removed when digested with BamH1
-
Entrez GeneCASP3 (a.k.a. CPP32, CPP32B, SCA-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmAmetrine-DEVD-tdTomato was a gift from Robert Campbell (Addgene plasmid # 18879 ; http://n2t.net/addgene:18879 ; RRID:Addgene_18879) -
For your References section:
Fluorescent protein FRET pairs for ratiometric imaging of dual biosensors. Ai HW, Hazelwood KL, Davidson MW, Campbell RE. Nat Methods. 2008 May . 5(5):401-3. 10.1038/nmeth.1207 PubMed 18425137