pSP019
(Plasmid
#168195)
-
Purposeexpresses proteolytically inactive EatA passenger domain with H134R mutation within the protease catalytic triad.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4126
- Total vector size (bp) 8313
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeatA[H134R]
-
SpeciesE. coli
-
Insert Size (bp)4092
-
MutationH134R mutation
-
GenBank IDAY163491
- Promoter araBAD
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer ATTTAATCTGTATCAGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSP019 was a gift from James Fleckenstein (Addgene plasmid # 168195 ; http://n2t.net/addgene:168195 ; RRID:Addgene_168195)