Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMEH343 CD63 MS2 HA
(Plasmid #168217)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168217 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA 3.1+ Hygro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5569
  • Total vector size (bp) 7048
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD63
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1479
  • Promoter CMV
  • Tags / Fusion Proteins
    • MS2 dimer (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMVF CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGHR TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMEH343 CD63 MS2 HA was a gift from Joshua Leonard (Addgene plasmid # 168217 ; http://n2t.net/addgene:168217 ; RRID:Addgene_168217)
  • For your References section:

    A platform for actively loading cargo RNA to elucidate limiting steps in EV-mediated delivery. Hung ME, Leonard JN. J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016. PubMed 27189348