CSAC-Pers
(Plasmid
#168281)
-
PurposeExpresses sgRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-hU6-gRNA-hSyn-mCherry-KASH
- Backbone size w/o insert (bp) 5294
- Total vector size (bp) 6010
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehU6-sgPer1-3-hU6-sgPer2-1-hU6-sgPer2-2
-
Alt nameCSAC-Pers
-
gRNA/shRNA sequenceGGATGCGCTCGGCAATGAGT, GGATGGCGAGCATCAAGGGC, GAGCACAACCCCTCCACGAG
-
SpeciesM. musculus (mouse)
- Promoter U6, hSyn
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer pUC_F ggagcctatggaaaaacgccag
- 3′ sequencing primer hSyn_R gtcggtcgtcaggtaggcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When comparing to the depositor reference sequence, please note that the mutations K14E, N210D, and E249G in mCherry-KASH do not alter plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSAC-Pers was a gift from Han Kyoung Choe (Addgene plasmid # 168281 ; http://n2t.net/addgene:168281 ; RRID:Addgene_168281) -
For your References section:
Multiplexed CRISPR-Cas9 system in a single adeno-associated virus to simultaneously knock out redundant clock genes. Kim B, Kim J, Chun M, Park I, Kwak D, Choi M, Kim K, Choe HK. Sci Rep. 2021 Jan 28;11(1):2575. doi: 10.1038/s41598-021-82287-0. 10.1038/s41598-021-82287-0 PubMed 33510438