Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-HDR-mEGFP-camk2a
(Plasmid #104589)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104589 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX551
  • Backbone size w/o insert (bp) 2905
  • Total vector size (bp) 5836
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    calcium/calmodulin-dependent protein kinase II alpha
  • Alt name
    camk2a
  • gRNA/shRNA sequence
    ctgcctgcccagtgccagga
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Camk2a (a.k.a. CaMKII, mKIAA0968)
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-HDR-mEGFP-camk2a was a gift from Ryohei Yasuda (Addgene plasmid # 104589 ; http://n2t.net/addgene:104589 ; RRID:Addgene_104589)
  • For your References section:

    Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Nishiyama J, Mikuni T, Yasuda R. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004. 10.1016/j.neuron.2017.10.004 PubMed 29056297