-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | |
AAV9 | 45186-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $380 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a-WPRE
- Total vector size (bp) 1700
-
Vector typeMammalian Expression, AAV ; adeno-associated viral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepAAV-Ef1a-Brainbow/mCherry/mTFP-WPRE
-
Speciescoral fluorescent proteins
-
Insert Size (bp)1700
- Promoter human EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer gatcttggttcattctcaagcctcag
- 3′ sequencing primer tagcgtaaaaggagcaacatagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bycloned by Kim Cohen and Dawen Cai
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for AAV9 (Catalog # 45186-AAV9) ( Back to top )
Purpose
Ready-to-use AAV9 particles produced from AAV-EF1a-BbChT (#45186). In addition to the viral particles, you will also receive purified AAV-EF1a-BbChT plasmid DNA.
Brainbow construct encoding mCherry and mTFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCherry, mTFP, or none
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EF1a-BbChT was a gift from Dawen Cai & Joshua Sanes (Addgene plasmid # 45186 ; http://n2t.net/addgene:45186 ; RRID:Addgene_45186)
For viral preps, please replace (Addgene plasmid # 45186) in the above sentence with: (Addgene viral prep # 45186-AAV9)
-
For your References section:
Improved tools for the Brainbow toolbox. Cai D, Cohen KB, Luo T, Lichtman JW, Sanes JR. Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5. 10.1038/nmeth.2450 PubMed 23817127