gRNAy
(Plasmid
#168294)
-
PurposeExpresses gRNA targeting the yellow gene in Drosophila
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepiggyBac
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 7487
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6.3-gRNA[y]-scaffold
-
gRNA/shRNA sequenceGGTCCTGGACACCGGAACCGTGG
-
SpeciesD. melanogaster (fly); D. suzukii
-
GenBank IDyellow
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNAy was a gift from Omar Akbari (Addgene plasmid # 168294 ; http://n2t.net/addgene:168294 ; RRID:Addgene_168294) -
For your References section:
Genetically Encoded CRISPR Components Yield Efficient Gene Editing in the Invasive Pest Drosophila suzukii. Kandul NP, Belikoff EJ, Liu J, Buchman A, Li F, Yamamoto A, Yang T, Shriner I, Scott MJ, Akbari OS. CRISPR J. 2021 Oct;4(5):739-751. doi: 10.1089/crispr.2021.0032. 10.1089/crispr.2021.0032 PubMed 34661429