Skip to main content

HyPer7.2DAAO-NES
(Plasmid #168301)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168301 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4095
  • Total vector size (bp) 6679
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HyPer7.2DAAO-NES
  • Species
    Synthetic
  • Insert Size (bp)
    2598
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCGATGGCTGCCAAGTACA
  • 3′ sequencing primer TGACCATGATTACGCCAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Partial sequence was a gift from Vsevolod Belousov Lab.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HyPer7.2DAAO-NES was a gift from Thomas Michel (Addgene plasmid # 168301 ; http://n2t.net/addgene:168301 ; RRID:Addgene_168301)
  • For your References section:

    Differential endothelial signaling responses elicited by chemogenetic H2O2 synthesis. Saeedi Saravi SS, Eroglu E, Waldeck-Weiermair M, Sorrentino A, Steinhorn B, Belousov V, Michel T. Redox Biol. 2020 Sep;36:101605. doi: 10.1016/j.redox.2020.101605. Epub 2020 Jun 16. 10.1016/j.redox.2020.101605 PubMed 32590330