LifeAct-TagBFP-DiB-RM
(Plasmid #168782)

• Purpose: Actin filament reporter, LifeAct, fused with blue fluorescent protein TagBFP and fluorogen activating protein (FAP) DiB-RM
• Depositing Lab: Jens Meiler
• Publication: Bozhanova et al PLoS Comput Biol. 2021 Nov 8;17(11):e1009555. doi: 10.1371/journal.pcbi.1009555. eCollection 2021 Nov.

Backbone

• Vector backbone: pDendra2-N
• Backbone size w/o insert (bp): 3948
• Total vector size (bp): 5220
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LifeAct-TagBFP-DiB-RM
• Species: Synthetic
• Insert Size (bp): 1272
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAAGTTAACAACAACAATTGCAT

Resource Information

• Supplemental Documents:
  • lifeact-tagbfp-dib-rm.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry