pGem-LP2-loxP-bar-lox2272-71
(Plasmid
#168786)
-
PurposeVector to create landing pad 2 (LP2) by homologous recombination in Aspergillus nidulans IS1 site. The strain A. nidulans LP2 is used for recombinase mediated chromosomal integration.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEM
- Backbone size w/o insert (bp) 3033
- Total vector size (bp) 6560
-
Vector typeCre/Lox, Synthetic Biology
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namebar
-
Alt nameGlufosinate/basta-resistance
-
SpeciesSynthetic; Streptomyces hygroscopicus
-
Insert Size (bp)939
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCGGAAGCGATAACACGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIS1 Homology arm 1
-
SpeciesAspergillus nidulans
-
Insert Size (bp)1040
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameIS1 Homology arm 2
-
SpeciesAspergillus nidulans
-
Insert Size (bp)1033
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GACGTGGGTTTCTGGCA
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameloxP
-
SpeciesSynthetic
-
Insert Size (bp)34
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer GACGTGGGTTTCTGGCAG
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namelox2272-71
-
SpeciesSynthetic
-
Insert Size (bp)34
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site PmII (destroyed during cloning)
- 3′ cloning site AatII (destroyed during cloning)
- 5′ sequencing primer AATGCTTCGAGGTCCTGTATTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector used to create Aspergillus nidulans parental strains with LP2 by polyethylene glycol (PEG)-calcium-based transformation with NotI linearized vector pGemLP2-loxP-bar-Lox2272-71 containing 1 kb homology regions at 5′ and 3′ of the floxed bar to facilitate homologous recombination in IS1 locus of A. nidulans. Colonies are selected for resistance to glufosinate extracted from Basta.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGem-LP2-loxP-bar-lox2272-71 was a gift from Yit Heng Chooi (Addgene plasmid # 168786 ; http://n2t.net/addgene:168786 ; RRID:Addgene_168786) -
For your References section:
Cre/lox-Mediated Chromosomal Integration of Biosynthetic Gene Clusters for Heterologous Expression in Aspergillus nidulans. Roux I, Chooi YH. ACS Synth Biol. 2022 Feb 16. doi: 10.1021/acssynbio.1c00458. 10.1021/acssynbio.1c00458 PubMed 35168324