PB_iETV2_P2A_GFP_Puro
(Plasmid #168805)

• Purpose: PiggyBac transposon construct with doxycycline inducible ETV2 + GFP expression
• Depositing Lab: Prashant Mali
• Publication: Dailamy et al Stem Cell Reports. 2021 Sep 8. pii: S2213-6711(21)00432-X. doi: 10.1016/j.stemcr.2021.08.014.

Backbone

• Vector backbone: PB-TRE
• Backbone size w/o insert (bp): 7527
• Total vector size (bp): 1896
• Vector type: Mammalian Expression, Synthetic Biology ; PiggyBac
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ETV2
• Alt name: ETV2-P2A-GFP
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1896
• Entrez Gene: ETV2 (a.k.a. ER71, ETSRP71)
• Promoter: TRE

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagatcgcctggagcaattc
• 3′ sequencing primer: ttgtctccttccgtgtttca

Resource Information

• Supplemental Documents:
  • PB_iETV2_P2A_GFP_Puro.gbk.ape
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry