Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB_iMYOD1_P2A_BAF60C2_T2A_mCh_Puro
(Plasmid #168807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168807 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB-TRE
  • Backbone size w/o insert (bp) 7527
  • Total vector size (bp) 10767
  • Vector type
    Mammalian Expression, Synthetic Biology ; PiggyBac
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MYOD1
  • Alt name
    MYOD1-P2A-BAF60C-T2A-mCherry
  • Species
    H. sapiens (human), Synthetic
  • GenBank ID
  • Promoter TRE

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagatcgcctggagcaattc
  • 3′ sequencing primer ttgtctccttccgtgtttca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB_iMYOD1_P2A_BAF60C2_T2A_mCh_Puro was a gift from Prashant Mali (Addgene plasmid # 168807 ; http://n2t.net/addgene:168807 ; RRID:Addgene_168807)
  • For your References section:

    Programmatic introduction of parenchymal cell types into blood vessel organoids. Dailamy A, Parekh U, Katrekar D, Kumar A, McDonald D, Moreno A, Bagheri P, Ng TN, Mali P. Stem Cell Reports. 2021 Sep 8. pii: S2213-6711(21)00432-X. doi: 10.1016/j.stemcr.2021.08.014. 10.1016/j.stemcr.2021.08.014 PubMed 34559998