Skip to main content

pInducer10-UBC9-sh4
(Plasmid #168988)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168988 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pInducer-10
  • Backbone size w/o insert (bp) 13217
  • Total vector size (bp) 13261
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ubiquitin Conjugating Enzyme 9
  • Alt name
    UBC9
  • gRNA/shRNA sequence
    cggaatacaggaacttctaaat
  • Species
    H. sapiens (human)
  • Promoter Ubc promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cggcttccacttcgtggaccacag
  • 3′ sequencing primer ctgatccttccgcccggacgctcag
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pInducer10-UBC9-sh4 was a gift from Ji Luo (Addgene plasmid # 168988 ; http://n2t.net/addgene:168988 ; RRID:Addgene_168988)
  • For your References section:

    Oncogenesis driven by the Ras/Raf pathway requires the SUMO E2 ligase Ubc9. Yu B, Swatkoski S, Holly A, Lee LC, Giroux V, Lee CS, Hsu D, Smith JL, Yuen G, Yue J, Ann DK, Simpson RM, Creighton CJ, Figg WD, Gucek M, Luo J. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):E1724-33. doi: 10.1073/pnas.1415569112. Epub 2015 Mar 24. 10.1073/pnas.1415569112 PubMed 25805818