MSCVhyg-HA-FLAG_Ubc9_WT
(Plasmid
#164936)
-
PurposeExpresses FLAG & HA tagged human uman Ubiquitin Conjugating Enzyme 9 (UBC9) wild type cDNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCVhyg
- Backbone size w/o insert (bp) 6974
- Total vector size (bp) 7557
-
Vector typeRetroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman UBC9
-
SpeciesH. sapiens (human)
-
GenBank IDNM_194260.3 NM_194260.3
-
Entrez GeneUBE2I (a.k.a. C358B7.1, P18, UBC9)
- Promoter PGK promoter
-
Tag
/ Fusion Protein
- FLAG & HA tags (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GACAAATGGAAGTAGCACGTCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCVhyg-HA-FLAG_Ubc9_WT was a gift from Ji Luo (Addgene plasmid # 164936 ; http://n2t.net/addgene:164936 ; RRID:Addgene_164936) -
For your References section:
Oncogenesis driven by the Ras/Raf pathway requires the SUMO E2 ligase Ubc9. Yu B, Swatkoski S, Holly A, Lee LC, Giroux V, Lee CS, Hsu D, Smith JL, Yuen G, Yue J, Ann DK, Simpson RM, Creighton CJ, Figg WD, Gucek M, Luo J. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):E1724-33. doi: 10.1073/pnas.1415569112. Epub 2015 Mar 24. 10.1073/pnas.1415569112 PubMed 25805818