mNeonGreen-Sec61β
(Plasmid
#169031)
-
PurposeGeneral ER marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemNeonGreen-C1
-
Backbone manufacturerAllele Biotechnology
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 4998
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec61β
-
SpeciesH. sapiens (human)
-
Insert Size (bp)295
-
Entrez GeneSEC61B
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GGAGCTCAAGCACTCCAAGA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains minor discrepancies in the linker region between Sec61B and mNeonGreen compared to the depositor's sequence. These differences do not affect the plasmid's functions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mNeonGreen-Sec61β was a gift from Gia Voeltz (Addgene plasmid # 169031 ; http://n2t.net/addgene:169031 ; RRID:Addgene_169031) -
For your References section:
Reticulon-3 Promotes Endosome Maturation at ER Membrane Contact Sites. Wu H, Voeltz GK. Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014. 10.1016/j.devcel.2020.12.014 PubMed 33434526