mNeonGreen-Sec61β
(Plasmid #169031)

• Purpose: General ER marker
• Depositing Lab: Gia Voeltz
• Publication: Wu et al Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014.

Backbone

• Vector backbone: mNeonGreen-C1
• Backbone manufacturer: Allele Biotechnology
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 4998
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sec61β
• Species: H. sapiens (human)
• Insert Size (bp): 295
• Entrez Gene: SEC61B
• Promoter: CMV
• Tag / Fusion Protein:
  • mNeonGreen (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: GGAGCTCAAGCACTCCAAGA
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Resource Information

• Supplemental Documents:
  • mNG-Sec61b.txt.xdna.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains minor discrepancies in the linker region between Sec61B and mNeonGreen compared to the depositor's sequence. These differences do not affect the plasmid's functions.