Rtn4a-mNeonGreen
(Plasmid
#169032)
-
PurposeExpress human Rtn4a
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemNeonGreen-N1
-
Backbone manufacturerAllele Biotechnology
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 8269
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRtn4a
-
Alt nameNogoA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3577
-
Entrez GeneRTN4 (a.k.a. ASY, NI220/250, NOGO, NSP, NSP-CL, Nbla00271, Nbla10545, RTN-X, RTN4-A, RTN4-B1, RTN4-B2, RTN4-C)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rtn4a-mNeonGreen was a gift from Gia Voeltz (Addgene plasmid # 169032 ; http://n2t.net/addgene:169032 ; RRID:Addgene_169032) -
For your References section:
Reticulon-3 Promotes Endosome Maturation at ER Membrane Contact Sites. Wu H, Voeltz GK. Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014. 10.1016/j.devcel.2020.12.014 PubMed 33434526