pDestTol2CG2-mnx1:ReaChR-citrine
(Plasmid
#169046)
-
PurposeDestination transgenesis vector for expressing ReaChR fused with citrine in zebrafish spinal motor neurons using 3 tandem repeats of the mnx1 enhancer.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDestTol2CG2
-
Backbone manufacturerChi-Bin Chien lab
- Backbone size w/o insert (bp) 7796
- Total vector size (bp) 8525
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReaChR-Citrine
-
SpeciesSynthetic
-
Insert Size (bp)1776
-
GenBank IDKF448069
- Promoter 3xMnx1
-
Tag
/ Fusion Protein
- Citrine (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene 50956
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDestTol2CG2-mnx1:ReaChR-citrine was a gift from Paola Arlotta (Addgene plasmid # 169046 ; http://n2t.net/addgene:169046 ; RRID:Addgene_169046) -
For your References section:
Long-Range Optogenetic Control of Axon Guidance Overcomes Developmental Boundaries and Defects. Harris JM, Wang AY, Boulanger-Weill J, Santoriello C, Foianini S, Lichtman JW, Zon LI, Arlotta P. Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009. 10.1016/j.devcel.2020.05.009 PubMed 32516597