pcDNA3 - ciRS-7
(Plasmid
#169139)
-
PurposeExpression of human CDR1as/ciRS-7 circRNA
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 9035
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCDR1as/ciRS-7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3683
-
Entrez GeneCDR1-AS (a.k.a. CDR1NAT, CDR1as, CIRS7, ciRS-7)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 - ciRS-7 was a gift from Thomas Hansen & Jørgen Kjems (Addgene plasmid # 169139 ; http://n2t.net/addgene:169139 ; RRID:Addgene_169139) -
For your References section:
Natural RNA circles function as efficient microRNA sponges. Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, Kjems J. Nature. 2013 Mar 21;495(7441):384-8. doi: 10.1038/nature11993. Epub 2013 Feb 27. 10.1038/nature11993 PubMed 23446346