Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHRSin_hTCRβε
(Plasmid #187354)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 187354 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHRSinGFP2
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPa3b17 hTCR beta, and truncated hCD3 epsilon
  • Species
    H. sapiens (human)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHRSin_hTCRβε was a gift from Simon Davis (Addgene plasmid # 187354 ; http://n2t.net/addgene:187354 ; RRID:Addgene_187354)
  • For your References section:

    Structure of a fully assembled tumor-specific T cell receptor ligated by pMHC. Susac L, Vuong MT, Thomas C, von Bulow S, O'Brien-Ball C, Santos AM, Fernandes RA, Hummer G, Tampe R, Davis SJ. Cell. 2022 Aug 18;185(17):3201-3213.e19. doi: 10.1016/j.cell.2022.07.010. 10.1016/j.cell.2022.07.010 PubMed 35985289