Skip to main content

pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
(Plasmid #169164)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169164 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBIG2ab (biGBac)
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nsp14/nsp10-6His-3xFlag
  • Alt name
    Sf nsp14/nsp10-HF
  • Alt name
    SARS-CoV-2 nsp14/10 exoribonuclease
  • Species
    Synthetic; SARS-CoV-2
  • Mutation
    Codon optimised for insect cells (Spodoptera frugiperda)
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • 6His-3xFlag (nsp10 C-terminus)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
  • 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Baculovirus generation using Tn7 transposition (Bac-to-Bac).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169164 ; http://n2t.net/addgene:169164 ; RRID:Addgene_169164)
  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp14/nsp10 exoribonuclease. Canal B, McClure AW, Curran JF, Wu M, Ulferts R, Weissmann F, Zeng J, Bertolin AP, Milligan JC, Basu S, Drury LS, Deegan TD, Fujisawa R, Roberts EL, Basier C, Labib K, Beale R, Howell M, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2445-2464. doi: 10.1042/BCJ20210198. 10.1042/BCJ20210198 PubMed 34198326