Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
(Plasmid #169164)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169164 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nsp14/nsp10-6His-3xFlag
  • Alt name
    Sf nsp14/nsp10-HF
  • Alt name
    SARS-CoV-2 nsp14/10 exoribonuclease
  • Species
    Synthetic; SARS-CoV-2
  • Mutation
    Codon optimised for insect cells (Spodoptera frugiperda)
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • 6His-3xFlag (nsp10 C-terminus)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
  • 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Baculovirus generation using Tn7 transposition (Bac-to-Bac).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169164 ; http://n2t.net/addgene:169164 ; RRID:Addgene_169164)
  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp14/nsp10 exoribonuclease. Canal B, McClure AW, Curran JF, Wu M, Ulferts R, Weissmann F, Zeng J, Bertolin AP, Milligan JC, Basu S, Drury LS, Deegan TD, Fujisawa R, Roberts EL, Basier C, Labib K, Beale R, Howell M, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2445-2464. doi: 10.1042/BCJ20210198. 10.1042/BCJ20210198 PubMed 34198326