pBIG2abc_nsp12-3xFlag/nsp7-His6-nsp8 (SARS-CoV-2)
(Plasmid
#169183)
-
PurposeBaculoviral transfer vector to co-express nsp12-3xFlag and nsp7-His6-nsp8 fusion in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBIG2abc (biGBac)
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namensp12-3xFlag/nsp7-His6-nsp8
-
Alt namensp12-F/7H8
-
Alt nameSARS-CoV-2 nsp12/7-8
-
SpeciesSARS-CoV-2
-
MutationCodon optimised for insect cells (Spodoptera frugiperda)
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter Polyhedrin
-
Tags
/ Fusion Proteins
- 3xFlag (nsp12 C-terminus)
- His6 (as internal tag linking nsp7 and nsp8): nsp7-His6-nsp8
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
- 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Baculovirus generation using Tn7 transposition (Bac-to-Bac).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBIG2abc_nsp12-3xFlag/nsp7-His6-nsp8 (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169183 ; http://n2t.net/addgene:169183 ; RRID:Addgene_169183) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp12/7/8 RNA-dependent RNA polymerase. Bertolin AP, Weissmann F, Zeng J, Posse V, Milligan JC, Canal B, Ulferts R, Wu M, Drury LS, Howell M, Beale R, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2425-2443. doi: 10.1042/BCJ20210200. 10.1042/BCJ20210200 PubMed 34198323