pK27Sumo_His-SUMO-nsp8 (SARS-CoV-2)
(Plasmid
#169187)
-
PurposeTo express His-SUMO-nsp8 (SARS-CoV-2) in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169187 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepK27Sumo
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name14His-SUMO-nsp8
-
Alt nameSARS-CoV-2 nsp8
-
SpeciesSynthetic; SARS-CoV-2
-
MutationCodon optimised for E. coli
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T5
-
Tag
/ Fusion Protein
- 14His-SUMO (Ulp1-cleavable) (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTCAAGCCTGAGACTCACATC
- 3′ sequencing primer CGTTTCCCGTTGAATATGGCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK27Sumo_His-SUMO-nsp8 (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169187 ; http://n2t.net/addgene:169187 ; RRID:Addgene_169187) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp12/7/8 RNA-dependent RNA polymerase. Bertolin AP, Weissmann F, Zeng J, Posse V, Milligan JC, Canal B, Ulferts R, Wu M, Drury LS, Howell M, Beale R, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2425-2443. doi: 10.1042/BCJ20210200. 10.1042/BCJ20210200 PubMed 34198323