pLIB_GST-nsp13 (SARS-CoV-2)
(Plasmid
#169190)
-
PurposeBaculoviral transfer vector to express GST-nsp13 (SARS-CoV-2) in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIB (biGBac)
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGST-nsp13
-
Alt nameSARS-CoV-2 nsp13 helicase
-
SpeciesSynthetic; SARS-CoV-2
-
MutationCodon optimised for insect cells (Spodoptera frugiperda)
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
- 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Baculovirus generation using Tn7 transposition (Bac-to-Bac).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIB_GST-nsp13 (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169190 ; http://n2t.net/addgene:169190 ; RRID:Addgene_169190) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp13 helicase. Zeng J, Weissmann F, Bertolin AP, Posse V, Canal B, Ulferts R, Wu M, Harvey R, Hussain S, Milligan JC, Roustan C, Borg A, McCoy L, Drury LS, Kjaer S, McCauley J, Howell M, Beale R, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2405-2423. doi: 10.1042/BCJ20210201. 10.1042/BCJ20210201 PubMed 34198322