-
PurposeAAV transfer plasmid for neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8s, with a flexible GS-linker sequence attaching the ribosomal tag to the jGCaMP8s protein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRiboL1-jGCaMP8s
-
SpeciesM. musculus (mouse), R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
-
Insert Size (bp)1998
- Promoter hSyn
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
- 3′ sequencing primer cagcgtatccacatagcgtaaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRibo tag from #158777 and GCaMP8s from #162374.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hSyn-RiboL1-jGCaMP8s was a gift from Marianne Fyhn (Addgene plasmid # 169247 ; http://n2t.net/addgene:169247 ; RRID:Addgene_169247) -
For your References section:
An updated suite of viral vectors for in vivo calcium imaging using intracerebral and retro-orbital injections in male mice. Grodem S, Nymoen I, Vatne GH, Rogge FS, Bjornsdottir V, Lensjo KK, Fyhn M. Nat Commun. 2023 Feb 4;14(1):608. doi: 10.1038/s41467-023-36324-3. 10.1038/s41467-023-36324-3 PubMed 36739289