Skip to main content

pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene
(Plasmid #169273)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169273 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RBM28 Exon1-6 WT minigene
  • Species
    H. sapiens (human)
  • Entrez Gene
    RBM28 (a.k.a. ANES, NOP4)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATAGAAGACACCGGGACCGA
  • 3′ sequencing primer GGCAAACAACAGATGGCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene was a gift from Susan Baserga (Addgene plasmid # 169273 ; http://n2t.net/addgene:169273 ; RRID:Addgene_169273)
  • For your References section:

    Biallelic splicing variants in the nucleolar 60S assembly factor RBM28 cause the ribosomopathy ANE syndrome. Bryant CJ, Lorea CF, de Almeida HL Jr, Weinert L, Vedolin L, Pinto E Vairo F, Baserga SJ. Proc Natl Acad Sci U S A. 2021 May 11;118(19). pii: 2017777118. doi: 10.1073/pnas.2017777118. 10.1073/pnas.2017777118 PubMed 33941690