pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene
(Plasmid
#169273)
-
PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 WT minigene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRBM28 Exon1-6 WT minigene
-
SpeciesH. sapiens (human)
-
Entrez GeneRBM28 (a.k.a. ANES, NOP4)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATAGAAGACACCGGGACCGA
- 3′ sequencing primer GGCAAACAACAGATGGCTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBAC clone RP11-640G20
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene was a gift from Susan Baserga (Addgene plasmid # 169273 ; http://n2t.net/addgene:169273 ; RRID:Addgene_169273) -
For your References section:
Biallelic splicing variants in the nucleolar 60S assembly factor RBM28 cause the ribosomopathy ANE syndrome. Bryant CJ, Lorea CF, de Almeida HL Jr, Weinert L, Vedolin L, Pinto E Vairo F, Baserga SJ. Proc Natl Acad Sci U S A. 2021 May 11;118(19). pii: 2017777118. doi: 10.1073/pnas.2017777118. 10.1073/pnas.2017777118 PubMed 33941690