pTS2163
(Plasmid
#169632)
-
PurposeTier-3 vector for CRISPR-mediated stable integration into the AAVS1 locus of the tetON-system (OTetO7-PCMVmin-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::A3-pA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169632 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTS1100 (pUC57-based)
- Backbone size w/o insert (bp) 5908
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOTetO7-PCMVmin-SEAP-iRFP670::PmPGK1-rtTA-pA::A3
-
SpeciesH. sapiens (human); Synthetic
- Promoter tetO7-PhCMVmin / PPGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer AmpStart
- 3′ sequencing primer CTGGCACGACAGGTTTCCCGACTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTS2163 was a gift from Martin Fussenegger (Addgene plasmid # 169632 ; http://n2t.net/addgene:169632 ; RRID:Addgene_169632) -
For your References section:
A versatile plasmid architecture for mammalian synthetic biology (VAMSyB). Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M. Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. 10.1016/j.ymben.2021.04.003 PubMed 33857582