Equalizer-L plasmid
(Plasmid
#169732)
-
PurposeEqualizer variant plasmid with low eGFP output levels but the best gene dosage compensation capability.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5/FRT
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6104
- Total vector size (bp) 8000
-
Modifications to backboneTetO2 site and rabbit beta-globin intron II (bGlob intron) are added to the 5' UTR. Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is added to the 3' UTR.
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
-
SpeciesSynthetic
-
Insert Size (bp)1896
- Promoter pCMV-tetO2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Equalizer-L plasmid was a gift from Francois St-Pierre (Addgene plasmid # 169732 ; http://n2t.net/addgene:169732 ; RRID:Addgene_169732) -
For your References section:
A synthetic circuit for buffering gene dosage variation between individual mammalian cells. Yang J, Lee J, Land MA, Lai S, Igoshin OA, St-Pierre F. Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0. 10.1038/s41467-021-23889-0 PubMed 34226556