Skip to main content

UBC plasmid
(Plasmid #169746)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169746 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Backbone size w/o insert (bp) 5422
  • Total vector size (bp) 6142
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Promoter UBC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgaagctccggttttgaact
  • 3′ sequencing primer ggcaactagaaggcacagtc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UBC plasmid was a gift from Francois St-Pierre (Addgene plasmid # 169746 ; http://n2t.net/addgene:169746 ; RRID:Addgene_169746)
  • For your References section:

    A synthetic circuit for buffering gene dosage variation between individual mammalian cells. Yang J, Lee J, Land MA, Lai S, Igoshin OA, St-Pierre F. Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0. 10.1038/s41467-021-23889-0 PubMed 34226556