Skip to main content

LentiCRISPRv2-ACTB-C1
(Plasmid #169796)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169796 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPRv2
  • Backbone manufacturer
    Addgene Plasmid #52961
  • Backbone size w/o insert (bp) 12993
  • Total vector size (bp) 13013
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    guide RNA for ACTB gene
  • gRNA/shRNA sequence
    ccgcctagaagcatttgcgg
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • 3′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-ACTB-C1 was a gift from Natsuko Chiba (Addgene plasmid # 169796 ; http://n2t.net/addgene:169796 ; RRID:Addgene_169796)
  • For your References section:

    Evaluation of site-specific homologous recombination activity of BRCA1 by direct quantitation of gene editing efficiency. Yoshino Y, Endo S, Chen Z, Qi H, Watanabe G, Chiba N. Sci Rep. 2019 Feb 7;9(1):1644. doi: 10.1038/s41598-018-38311-x. 10.1038/s41598-018-38311-x PubMed 30733539