pFnCas12a_NT
(Plasmid
#169838)
-
PurposeExpresses FnCas12a and guide RNA in Bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNW33n
- Backbone size w/o insert (bp) 4447
- Total vector size (bp) 8350
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFnCas12a
-
gRNA/shRNA sequenceCas12a gRNA
-
SpeciesFrancisella tularensis subsp. novicida
-
GenBank IDWP_003040289.1
- Promoter pXynA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGCAAGCAGCAGATTACG
- 3′ sequencing primer TGCGGCTGTGAAAGAATTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe gene was cloned from pY002 (pFnCpf1_min) (Plasmid #69975).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFnCas12a_NT was a gift from John van der Oost (Addgene plasmid # 169838 ; http://n2t.net/addgene:169838 ; RRID:Addgene_169838) -
For your References section:
Development of a Cas12a-Based Genome Editing Tool for Moderate Thermophiles. Mohanraju P, Mougiakos I, Albers J, Mabuchi M, Fuchs RT, Curcuru JL, van Kranenburg R, Robb GB, van der Oost J. CRISPR J. 2021 Feb;4(1):82-91. doi: 10.1089/crispr.2020.0086. Epub 2021 Feb 4. 10.1089/crispr.2020.0086 PubMed 33538626