Skip to main content
Addgene

sgAAT Nicking
(Plasmid #169842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169842 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmd127
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgAAT Nicking
  • gRNA/shRNA sequence
    GGGTTTGTTGAACTTGACCT
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    SERPINA1 (a.k.a. A1A, A1AT, AAT, PI, PI1, PRO2275, alpha1AT, nNIF)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgAAT Nicking was a gift from Wen Xue (Addgene plasmid # 169842 ; http://n2t.net/addgene:169842 ; RRID:Addgene_169842)
  • For your References section:

    Improved prime editors enable pathogenic allele correction and cancer modelling in adult mice. Liu P, Liang SQ, Zheng C, Mintzer E, Zhao YG, Ponnienselvan K, Mir A, Sontheimer EJ, Gao G, Flotte TR, Wolfe SA, Xue W. Nat Commun. 2021 Apr 9;12(1):2121. doi: 10.1038/s41467-021-22295-w. 10.1038/s41467-021-22295-w PubMed 33837189