pMXS-IRES-BLAST TFR1
(Plasmid
#169890)
-
PurposeExpress TFR1 open reading frame. Lacks IRE regulatory elements
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMXS-IRES-BLAST
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7900
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTFRC
-
Alt nameTransferrin Receptor
-
Alt nameCD71
-
Alt nameTFR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2300
-
MutationTFRC cDNA, lacking 3'UTR regulatory elements
-
GenBank ID7037 NM_003234.4
-
Entrez GeneTFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer GGC GGA ATT TAC GTA GCG GCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXS-IRES-BLAST TFR1 was a gift from Richard Possemato (Addgene plasmid # 169890 ; http://n2t.net/addgene:169890 ; RRID:Addgene_169890) -
For your References section:
Iron-sulfur cluster deficiency can be sensed by IRP2 and regulates iron homeostasis and sensitivity to ferroptosis independent of IRP1 and FBXL5. Terzi EM, Sviderskiy VO, Alvarez SW, Whiten GC, Possemato R. Sci Adv. 2021 May 26;7(22). pii: 7/22/eabg4302. doi: 10.1126/sciadv.abg4302. Print 2021 May. 10.1126/sciadv.abg4302 PubMed 34039609